Mature sequence aly-miR4225

Accession numberMIMAT0017913
IDaly-miR4225
Stem-Loop aly-MIR4225
Sequence
gaaucgaugguuaaacaacac
Get sequence
Deep sequencing reads, experiments

References

1