Mature sequence aly-miR4227

Accession numberMIMAT0017915
IDaly-miR4227
Stem-Loop aly-MIR4227
Sequence
ucauuugugccaaucauucua
Get sequence
Deep sequencing reads, experiments

References

1