Mature sequence aly-miR4230

Accession numberMIMAT0017918
IDaly-miR4230
Stem-Loop aly-MIR4230
Sequence
ugucucggaaauuugcacccu
Get sequence
Deep sequencing reads, experiments

References

1