Mature sequence aly-miR4237

Accession numberMIMAT0017926
IDaly-miR4237
Stem-Loop aly-MIR4237
Sequence
aaacguaaacauauauaaucga
Get sequence
Deep sequencing reads, experiments

References

1