Mature sequence aly-miR4247

Accession numberMIMAT0017936
IDaly-miR4247
Stem-Loop aly-MIR4247
Sequence
uguauccuaauauuagacccc
Get sequence
Deep sequencing8 reads, 1 experiments

References

1