Mature sequence ath-miR4227

Accession numberMIMAT0017943
IDath-miR4227
Stem-Loop ath-MIR4227
Sequence
ucacugguaccaaucauucca
Get sequence
Deep sequencing reads, experiments

References

1