Mature sequence ssc-miR-362

Accession numberMIMAT0017958
IDssc-miR-362
Stem-Loop ssc-mir-362
Sequence
aauccuuggaaccuaggugugagug
Get sequence
Deep sequencing1007 reads, 15 experiments

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).