Mature sequence hsa-miR-3620-3p

Accession numberMIMAT0018001
IDhsa-miR-3620-3p
Previous IDshsa-miR-3620
Stem-Loop hsa-mir-3620
Sequence
ucacccugcaucccgcacccag
Get sequence
Deep sequencing256 reads, 43 experiments
Predicted targets

References

1