Mature sequence dme-miR-3644-5p

Accession numberMIMAT0018061
IDdme-miR-3644-5p
Previous IDsdme-miR-3644
Stem-Loop dme-mir-3644
Sequence
gugagugauuaugguuuaagua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20620959 "MicroRNA biogenesis via splicing and exosome-mediated trimming in Drosophila" Flynt AS, Greimann JC, Chung WJ, Lima CD, Lai EC Mol Cell. 38:900-907(2010).