Mature sequence hsa-miR-3658

Accession numberMIMAT0018078
IDhsa-miR-3658
Stem-Loop hsa-mir-3658
Sequence
uuuaagaaaacaccauggagau
Get sequence
Deep sequencing5 reads, 5 experiments
Predicted targets

References

1
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).