Mature sequence hsa-miR-3670

Accession numberMIMAT0018093
IDhsa-miR-3670
Stem-Loop hsa-mir-3670-1 hsa-mir-3670-2 hsa-mir-3670-3 hsa-mir-3670-4
Sequence
agagcucacagcuguccuucucua
Get sequence
Deep sequencing44 reads, 10 experiments

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).