Mature sequence hsa-miR-3909

Accession numberMIMAT0018183
IDhsa-miR-3909
Stem-Loop hsa-mir-3909
Sequence
uguccucuagggccugcagucu
Get sequence
Deep sequencing1873 reads, 125 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2