Mature sequence hvu-miR168-3p

Accession numberMIMAT0018216
IDhvu-miR168-3p
Stem-Loop hvu-MIR168
Sequence
gaucccgccuugcaccaagugaau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).
2
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).
3
PMID:23324356 "Developmentally regulated expression and complex processing of barley pri-microRNAs" Kruszka K, Pacak A, Swida-Barteczka A, Stefaniak AK, Kaja E, Sierocka I, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z BMC Genomics. 14:34(2013).