Mature sequence tae-miR395b

Accession numberMIMAT0018223
IDtae-miR395b
Stem-Loop tae-MIR395b
Sequence
ugaaguguuugggggaacuc
Get sequence
Deep sequencing15736 reads, 116 experiments

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).