Mature sequence tae-miR171b

Accession numberMIMAT0018227
IDtae-miR171b
Stem-Loop tae-MIR171b
Sequence
uugagccgugccaauaucacg
Get sequence
Deep sequencing36700 reads, 116 experiments

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).