Mature sequence gma-miR396d

Accession numberMIMAT0018262
IDgma-miR396d
Stem-Loop gma-MIR396d
Sequence
aagaaagcugugggagaauauggc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).