Mature sequence hvu-miR444a

Accession numberMIMAT0018503
IDhvu-miR444a
Previous IDshvu-miR444
Stem-Loop hvu-MIR444a
Sequence
uugcugccucaagcuugcugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).
2
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).