Mature sequence smr-miR-3930-3p

Accession numberMIMAT0018918
IDsmr-miR-3930-3p
Previous IDssmr-miR-3930*
Stem-Loop smr-mir-3930
Sequence
guacgccguagcagagucgcu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20702459 "A congruent solution to arthropod phylogeny: phylogenomics, microRNAs and morphology support monophyletic Mandibulata" Rota-Stabelli O, Campbell L, Brinkmann H, Edgecombe GD, Longhorn SJ, Peterson KJ, Pisani D, Philippe H, Telford MJ Proc Biol Sci. 278:298-306(2011).