Mature sequence hsa-miR-548ag

Accession numberMIMAT0018969
IDhsa-miR-548ag
Stem-Loop hsa-mir-548ag-1 hsa-mir-548ag-2
Sequence
aaagguaauugugguuucugc
Get sequence
Deep sequencing5369 reads, 144 experiments
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).