Mature sequence hsa-miR-4485-3p

Accession numberMIMAT0019019
IDhsa-miR-4485-3p
Previous IDshsa-miR-4485
Stem-Loop hsa-mir-4485
Sequence
uaacggccgcgguacccuaa
Get sequence
Deep sequencing12538 reads, 151 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).