Mature sequence hsa-miR-1269b

Accession numberMIMAT0019059
IDhsa-miR-1269b
Stem-Loop hsa-mir-1269b
Sequence
cuggacugagccaugcuacugg
Get sequence
Deep sequencing18539 reads, 76 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).