Mature sequence mmu-miR-378b

Accession numberMIMAT0019348
IDmmu-miR-378b
Stem-Loop mmu-mir-378b
Sequence
cuggacuuggagucagaaga
Get sequence
Deep sequencing9466262 reads, 107 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20935160 "Next-generation sequencing identifies the natural killer cell microRNA transcriptome" Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER Genome Res. 20:1590-1604(2010).