Mature sequence dme-miR-4963-3p

Accession numberMIMAT0020186
IDdme-miR-4963-3p
Stem-Loop dme-mir-4963
Sequence
auucucugcgggcuggaaccag
Get sequence
Deep sequencing55 reads, 28 experiments

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).