Mature sequence hvu-miR399

Accession numberMIMAT0020542
IDhvu-miR399
Stem-Loop hvu-MIR399
Sequence
ugccaaaggagauuugccccg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).