Mature sequence osa-miR5074

Accession numberMIMAT0020559
IDosa-miR5074
Stem-Loop osa-MIR5074
Sequence
gaaggccaccgucgggaucgc
Get sequence
Deep sequencing1 reads, 1 experiments
Database links
QuickGO function

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).