Mature sequence bdi-miR5070

Accession numberMIMAT0020584
IDbdi-miR5070
Stem-Loop bdi-MIR5070
Sequence
aacuaaguagggucagagggu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).