Mature sequence bdi-miR5200c

Accession numberMIMAT0020757
IDbdi-miR5200c
Previous IDsbdi-miR5200
Stem-Loop bdi-MIR5200c
Sequence
uguagauacucucuaaggcuu
Get sequence
Deep sequencing reads, experiments

References

1