Mature sequence sly-miR5300

Accession numberMIMAT0020764
IDsly-miR5300
Stem-Loop sly-MIR5300
Sequence
uccccaguccaggcauuccaac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21443685 "Profiling of short RNAs during fleshy fruit development reveals stage-specific sRNAome expression patterns" Mohorianu I, Schwach F, Jing R, Lopez-Gomollon S, Moxon S, Szittya G, Sorefan K, Moulton V, Dalmay T Plant J. 67:232-246(2011).