Mature sequence sly-miR482a

Accession numberMIMAT0020769
IDsly-miR482a
Previous IDssly-miR482
Stem-Loop sly-MIR482a
Sequence
uuuccaauuccacccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21443685 "Profiling of short RNAs during fleshy fruit development reveals stage-specific sRNAome expression patterns" Mohorianu I, Schwach F, Jing R, Lopez-Gomollon S, Moxon S, Szittya G, Sorefan K, Moulton V, Dalmay T Plant J. 67:232-246(2011).
2
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).