Accession | MIMAT0020823 |
Description | dme-bantam-5p mature miRNA |
Hairpins | |
Sequence | CCGGUUUUCGAUUUGGUUUGACU |
Evidence | not_experimental |
Database links |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0001654 eye development |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:16949821 | |
involved_in | GO:0008284 positive regulation of cell population proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:12871911 | |
involved_in | GO:0008284 positive regulation of cell population proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:16923395 | |
involved_in | GO:0030718 germ-line stem cell population maintenance |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:18213359 | |
involved_in | GO:0031104 dendrite regeneration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22759636 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:16503100 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:16503100 | |
involved_in | GO:0040014 regulation of multicellular organism growth |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:12196398 | |
involved_in | GO:0040018 positive regulation of multicellular organism growth |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:12871911 | |
involved_in | GO:0042127 regulation of cell population proliferation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:16949821 | |
involved_in | GO:0042981 regulation of apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18550049 | |
involved_in | GO:0045927 positive regulation of growth |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21238929 | |
involved_in | GO:0050773 regulation of dendrite development |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19778508 | |
involved_in | GO:0060288 formation of a compartment boundary |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21795284 | |
involved_in | GO:2000648 positive regulation of stem cell proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24262985 | |
involved_in | GO:2001233 regulation of apoptotic signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:16949821 |