Mature sequence gma-miR5042-5p

Accession numberMIMAT0021072
IDgma-miR5042-5p
Previous IDsgma-miR5042
Stem-Loop gma-MIR5042
Sequence
uaucuuggaucacagccccauu
Get sequence
Deep sequencing reads, experiments

References

1
2