Mature sequence osa-miR2275c

Accession numberMIMAT0022147
IDosa-miR2275c
Stem-Loop osa-MIR2275c
Sequence
agaauuggaggaaaacaaacuga
Get sequence
Deep sequencing1 reads, 1 experiments

References

1