Mature sequence hsa-miR-548aq-3p

Accession numberMIMAT0022264
IDhsa-miR-548aq-3p
Stem-Loop hsa-mir-548aq
Sequence
caaaaacugcaauuacuuuugc
Get sequence
Deep sequencing4295 reads, 106 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).