Mature sequence hsa-miR-548av-3p

Accession numberMIMAT0022304
IDhsa-miR-548av-3p
Stem-Loop hsa-mir-548av
Sequence
aaaacugcaguuacuuuugc
Get sequence
Deep sequencing1940 reads, 84 experiments
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).