Mature sequence gma-miR5669

Accession numberMIMAT0022451
IDgma-miR5669
Stem-Loop gma-MIR5669
Sequence
caauguagugugguaagugguc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).