Mature sequence gma-miR2111a

Accession numberMIMAT0022457
IDgma-miR2111a
Previous IDsgma-miR2111
Stem-Loop gma-MIR2111a
Sequence
guccuugggaugcagauuacg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).