Mature sequence gma-miR4401b

Accession numberMIMAT0022461
IDgma-miR4401b
Stem-Loop gma-MIR4401b
Sequence
ucaaagacguugcugagguaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).