Mature sequence gma-miR5677

Accession numberMIMAT0022465
IDgma-miR5677
Stem-Loop gma-MIR5677
Sequence
uuuggucuuuaaucaagcuga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).