Mature sequence gma-miR5679

Accession numberMIMAT0022467
IDgma-miR5679
Stem-Loop gma-MIR5679
Sequence
uuggugacccagaagaaguuga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).