Mature sequence hsa-miR-1304-3p

Accession numberMIMAT0022720
IDhsa-miR-1304-3p
Stem-Loop hsa-mir-1304
Sequence
ucucacuguagccucgaacccc
Get sequence
Deep sequencing3863 reads, 143 experiments
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).