Mature sequence hsa-miR-3191-5p

Accession numberMIMAT0022732
IDhsa-miR-3191-5p
Stem-Loop hsa-mir-3191
Sequence
cucucuggccgucuaccuucca
Get sequence
Deep sequencing8 reads, 6 experiments
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).