Mature sequence mmu-miR-299b-5p

Accession numberMIMAT0022836
IDmmu-miR-299b-5p
Stem-Loop mmu-mir-299b
Sequence
gguuuaccgucccacauacau
Get sequence
Deep sequencing89 reads, 24 experiments
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).