Mature sequence hsa-miR-1185-1-3p

Accession numberMIMAT0022838
IDhsa-miR-1185-1-3p
Stem-Loop hsa-mir-1185-1
Sequence
auauacagggggagacucuuau
Get sequence
Deep sequencing2905 reads, 110 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).