Mature sequence hsa-miR-1233-5p

Accession numberMIMAT0022943
IDhsa-miR-1233-5p
Stem-Loop hsa-mir-1233-1 hsa-mir-1233-2
Sequence
agugggaggccagggcacggca
Get sequence
Deep sequencing48 reads, 19 experiments
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).
2
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).