Mature sequence gma-miR396k-3p

Accession numberMIMAT0023219
IDgma-miR396k-3p
Previous IDsgma-miR396k
Stem-Loop gma-MIR396k
Sequence
gcucaagaaagcugugggaga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
2