Mature sequence bta-miR-574

Accession numberMIMAT0024577
IDbta-miR-574
Stem-Loop bta-mir-574
Sequence
ugagugugugugugugagugugug
Get sequence
Deep sequencing3609 reads, 72 experiments
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).