Mature sequence rno-miR-1839-5p

Accession numberMIMAT0024843
IDrno-miR-1839-5p
Stem-Loop rno-mir-1839
Sequence
aagguagauagaacaggucuug
Get sequence
Deep sequencing84414 reads, 498 experiments
Predicted targets

References

1
PMID:22470567 "Discovery of novel microRNAs in rat kidney using next generation sequencing and microarray validation" Meng F, Hackenberg M, Li Z, Yan J, Chen T PLoS One. 7:e34394(2012).
2
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
3
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).