Mature sequence mmu-miR-6239

Accession numberMIMAT0024860
IDmmu-miR-6239
Stem-Loop mmu-mir-6239
Sequence
uagcguuggaucacucggug
Get sequence
Deep sequencing3370 reads, 87 experiments
Predicted targets

References

1