Mature sequence gma-miR166r

Accession numberMIMAT0024900
IDgma-miR166r
Stem-Loop gma-MIR166r
Sequence
ucggaccaggcuucauuccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).