Mature sequence mja-miR-6493-5p

Accession numberMIMAT0025301
IDmja-miR-6493-5p
Stem-Loop mja-mir-6493
Sequence
acguccggcagguuuuaccccu
Get sequence
Deep sequencing reads, experiments

References

1